>------------------------------ GENE-ID OUTPUT -------------------------------< UPDATES: 1. New user-friendly interfaces available for Macintosh and Unix. See help file for more info: send email 'help' 2. Help! We are trying to obtain funding for continued maintenance and improvement of the GeneID server. If you think this server deserves to be continued, please say so in an email to: steen@bir.cedb.uwf.edu ________________________________________________________________________ GENEID ONLINE SYSTEM FOR PREDICTION OF GENE STRUCTURE version 1.1 3/1/1993 _______________________________________________________________________________ The GeneID server, which was first brought online at geneid@darwin.bu.edu in December 1991, has now had a few enhancements added: 1. It is now available at geneid@bir.cedb.uwf.edu as well. 2. Predicted gene models are automatically compared to protein databases. 3. Several options can be supplied on the "command line" (Genomic Sequence): -small_output : Mails only exons and gene models back to user. -all_exons : Allows scanning for exons in small gene fragments. -noblast : Turns off protein database search -netgene : Send the file to netgene as well. Example: Genomic Sequence -noblast -small_output 4. Error handling has been improved to supply a more meaningful feedback to the user, and be a little less unforgiving of user error. 5. The upper limit in sequence size has been increased from 20,000 bp to 200,000 bp. 6. Estimated confidence of predicted exons is given. Some of these enhancements are further described below. NOTE that all these enhancements are backwards compatible. Requests submitted in the old format to geneid@darwin.bu.edu, will be processed along with requests containing new options. _______________________________________________________________________________ GeneID is an Artificial Intelligence system for analyzing vertebrate genomic DNA and prediction of exons and gene structure (1). A prototype is implemented as a fast, automatic email-response system. Users have the option of having their DNA sequence analyzed by NetGene (2) simultaneously. REGISTRATION: No registration or user ID is required. Your return-path will be kept on file for determining the number and geographical distribution of users. SUBMITTING SEQUENCES: Your sequences must be submitted in the following format (approximately same format as used for fasta, BLAST and GRAIL): You can submit only one sequence per mail. Put the sequence after the keyword "Genomic Sequence" as shown below: Genomic Sequence >seqname TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCC CGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG GCCAACTCCATCACTA................... (Restrict the line length to 80 characters. The seqname is limited to 20 characters). NOTE>> IF YOUR MAIL DOES NOT CONTAIN THE KEYWORD "GENOMIC SEQUENCE", OR ANY OTHER KEYWORDS LISTED IN THIS FILE, NO MAIL WILL BE RETURNED TO YOU. On a UNIX system you could send the File containing the sequence as follows: mail -v geneid@bir.cedb.uwf.edu________________________________________